molecular weight dna ladder (New England Biolabs)
Structured Review
Molecular Weight Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 790 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/low+molecular+weight+dna+ladder/Low+Molecular+Weight+DNA+Ladder/bio_rxiv__64898__2026__05__02__722398-181-29-33
Average 96 stars, based on 790 article reviews
Images
Related Articles
Size Selection:Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci. Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Staining:Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci. Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Article Title: Method of DNA synthesis Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Molecular Weight:Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci. Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Article Title: Therapeutic potential of circular antisense oligonucleotides in gene silencing and RNA condensate degradation Article Snippet: Antisense oligonucleotides (ASOs) have emerged as a powerful therapeutic modality for targeting diseaseassociated RNA.. However, most clinical ASOs rely on chemical modifications to improve stability and pharmacokinetics.. Here, we present a chemically unmodified circular ASO (C-ASO) platform that exhibits enhanced exonuclease resistance, prolonged gene silencing, and the ability to dissociate RNA condensates. Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids. Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification. Article Title: Taq DNA polymerase variants with increased reverse transcriptase activity Article Snippet: The reaction protocol is as follows: 60° C. incubation for 20 minutes, 95° C. denature for 5 minutes, followed by 35 cycles of [95° C. 10 sec denaturing, 60° C. 30 sec extension], followed by 5 min incubation at 75° C. To each sample, 3 μl of 6× stop dye containing 6× GelRed nucleic acid stain (Biotium catalog #41003) was added. .. Samples were loaded, 10 μl each, into 2% agarose gels and compared to WT Taq polymerase and to Article Title: Method of DNA synthesis Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Sterility:Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci. Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Nucleic Acid Electrophoresis:Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Polymerase Chain Reaction:Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Imaging:Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Random Hexamer:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Reverse Transcription:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Gel Extraction:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Cloning:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Sequencing:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Library Amplification:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Multiplex Assay:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Spectrophotometry:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Electrophoresis:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Agarose Gel Electrophoresis:Article Title: Profiling RNA G‐Quadruplexes In vivo Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Real-time Polymerase Chain Reaction:Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids. Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification. High Performance Liquid Chromatography:Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids. Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification. Purification:Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids. Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification. Synthesized:Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids. Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification. Produced:Article Title: Method of DNA synthesis Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Concentration Assay:Article Title: Method of DNA synthesis Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Sensitive Assay:Article Title: Method of DNA synthesis Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), |
