Review



molecular weight dna ladder  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    New England Biolabs molecular weight dna ladder
    Molecular Weight Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 777 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/low+molecular+weight+dna+ladder/Low+Molecular+Weight+DNA+Ladder/bio_rxiv__64898__2026__05__02__722398-181-29-33
    Average 96 stars, based on 777 article reviews
    molecular weight dna ladder - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Size Selection:

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci.
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Staining:

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci.
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Method of DNA synthesis
    Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Low Molecular Weight DNA Ladder (New England Biolabs), 10×TLG buffer reagent: 300 mM Tris HCl pH 7.4 (Sigma Aldrich), 300 mM KCl (Sigma Aldrich), 75 mM MgCl2 (Sigma Aldrich), 50 mM (NH4)2SO4 (Sigma Aldrich), nuclease free water (Sigma Aldrich) IBA Oligonucleotides (5′ to 3′): PEGS1: BiotinC6 attached to SEQ ID No. 24, PEGS2: SEQ ID No. 25, PEGS3: SEQ ID No. 26, PEGS4: SEQ ID No. 27, PEGS5: SEQ ID No. 28, PEGS6: SEQ ID No. 29, PEGS7: SEQ ID No. 30. ..

    Molecular Weight:

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci.
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Therapeutic potential of circular antisense oligonucleotides in gene silencing and RNA condensate degradation
    Article Snippet: Antisense oligonucleotides (ASOs) have emerged as a powerful therapeutic modality for targeting diseaseassociated RNA.. However, most clinical ASOs rely on chemical modifications to improve stability and pharmacokinetics.. Here, we present a chemically unmodified circular ASO (C-ASO) platform that exhibits enhanced exonuclease resistance, prolonged gene silencing, and the ability to dissociate RNA condensates.

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples
    Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Low molecular weight DNA ladder (New England Biolabs, cat. no. N3233L) Tris‐borate‐EDTA (TBE) buffer (Thermo Fisher Scientific, cat. no. B52) 0.2‐ml PCR tubes Vortex mixer 50‐ml centrifuge tube 10‐, 20‐, and 200‐μl pipettes and filter tips 2‐ml snap‐cap tubes, sterile Magnetic rack, e.g., MAGBIO MyMag 96× magnetic plate Gel electrophoresis system Gel imaging system ..

    Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids.
    Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification.

    Article Title: Taq DNA polymerase variants with increased reverse transcriptase activity
    Article Snippet: The reaction protocol is as follows: 60° C. incubation for 20 minutes, 95° C. denature for 5 minutes, followed by 35 cycles of [95° C. 10 sec denaturing, 60° C. 30 sec extension], followed by 5 min incubation at 75° C. To each sample, 3 μl of 6× stop dye containing 6× GelRed nucleic acid stain (Biotium catalog #41003) was added. .. Samples were loaded, 10 μl each, into 2% agarose gels and compared to WT Taq polymerase and to Low Molecular Weight DNA Ladder (New England Biolabs, catalog #N3233). ..

    Article Title: Method of DNA synthesis
    Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Low Molecular Weight DNA Ladder (New England Biolabs), 10×TLG buffer reagent: 300 mM Tris HCl pH 7.4 (Sigma Aldrich), 300 mM KCl (Sigma Aldrich), 75 mM MgCl2 (Sigma Aldrich), 50 mM (NH4)2SO4 (Sigma Aldrich), nuclease free water (Sigma Aldrich) IBA Oligonucleotides (5′ to 3′): PEGS1: BiotinC6 attached to SEQ ID No. 24, PEGS2: SEQ ID No. 25, PEGS3: SEQ ID No. 26, PEGS4: SEQ ID No. 27, PEGS5: SEQ ID No. 28, PEGS6: SEQ ID No. 29, PEGS7: SEQ ID No. 30. ..

    Sterility:

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci.
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Anthracyclines induce global changes in cardiomyocyte chromatin accessibility that overlap with cardiovascular disease loci
    Article Snippet: .. For gel-based size selection, DNA was loaded onto 2% Ultra Agarose gels (1613107, Bio-Rad) prepared in 1x TAE buffer (1610743, Bio-Rad) containing SYBR Safe DNA stain (Invitrogen, S33102 ), and run alongside a Low Molecular Weight DNA ladder (N3233L, NEB) at 120 V for 40 min. DNA fragments ranging from 250 - 400 bp were visualized using a blue light transilluminator and excised using sterile scalpels. .. Excised gel slices were purified using the MinElute Gel Extraction Kit (28606, Qiagen), following the manufacturer’s protocol.

    Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples
    Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Low molecular weight DNA ladder (New England Biolabs, cat. no. N3233L) Tris‐borate‐EDTA (TBE) buffer (Thermo Fisher Scientific, cat. no. B52) 0.2‐ml PCR tubes Vortex mixer 50‐ml centrifuge tube 10‐, 20‐, and 200‐μl pipettes and filter tips 2‐ml snap‐cap tubes, sterile Magnetic rack, e.g., MAGBIO MyMag 96× magnetic plate Gel electrophoresis system Gel imaging system ..

    Nucleic Acid Electrophoresis:

    Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples
    Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Low molecular weight DNA ladder (New England Biolabs, cat. no. N3233L) Tris‐borate‐EDTA (TBE) buffer (Thermo Fisher Scientific, cat. no. B52) 0.2‐ml PCR tubes Vortex mixer 50‐ml centrifuge tube 10‐, 20‐, and 200‐μl pipettes and filter tips 2‐ml snap‐cap tubes, sterile Magnetic rack, e.g., MAGBIO MyMag 96× magnetic plate Gel electrophoresis system Gel imaging system ..

    Polymerase Chain Reaction:

    Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples
    Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Low molecular weight DNA ladder (New England Biolabs, cat. no. N3233L) Tris‐borate‐EDTA (TBE) buffer (Thermo Fisher Scientific, cat. no. B52) 0.2‐ml PCR tubes Vortex mixer 50‐ml centrifuge tube 10‐, 20‐, and 200‐μl pipettes and filter tips 2‐ml snap‐cap tubes, sterile Magnetic rack, e.g., MAGBIO MyMag 96× magnetic plate Gel electrophoresis system Gel imaging system ..

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Imaging:

    Article Title: Dietary DNA Metabarcoding From Animal Fecal Samples
    Article Snippet: .. AMPure or home‐made Sera‐Mag SpeedBeads (see Support Protocol ) 100% ethanol (Sigma‐Aldrich, cat. no. E7023) H 2 O, nuclease‐free (New England Biolabs, cat. no. B1500S) 10 mM Tris·HCl, pH 8 (Sigma‐Aldrich, cat. no. 93363) Gel electrophoresis reagents: Agarose (Sigma‐Aldrich, cat. no. A9539) Ethidium bromide (Thermo Fisher Scientific, cat. no. 15585011) Low molecular weight DNA ladder (New England Biolabs, cat. no. N3233L) Tris‐borate‐EDTA (TBE) buffer (Thermo Fisher Scientific, cat. no. B52) 0.2‐ml PCR tubes Vortex mixer 50‐ml centrifuge tube 10‐, 20‐, and 200‐μl pipettes and filter tips 2‐ml snap‐cap tubes, sterile Magnetic rack, e.g., MAGBIO MyMag 96× magnetic plate Gel electrophoresis system Gel imaging system ..

    Random Hexamer:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Reverse Transcription:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Gel Extraction:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Cloning:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Sequencing:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Library Amplification:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Multiplex Assay:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Spectrophotometry:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Electrophoresis:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Agarose Gel Electrophoresis:

    Article Title: Profiling RNA G‐Quadruplexes In vivo
    Article Snippet: .. RNase‐free TURBO DNase, 2 U/μl (Invitrogen, AM2238) Poly(A)‐selected RNA (From Basic Protocol ) Nuclease‐free water (Invitrogen, AM9906) RNA Clean & Concentrator Kit (Zymo, R1016) dNTP set mix (100 mM each) (Invitrogen, 18427013) Random Hexamer (CAGACGTGTGCTCTTCCGATCT(N)(N)(N)(N)(N)) fused to the Illumina TruSeq adapter Superscript III Reverse Transcriptase (200 U/μl) (Invitrogen) RT buffer, 5 × (See recipe) RNaseOUT (40 U/μl) (Invitrogen, 10777019) RNase H (10U/μl) (Invitrogen, AM2293) Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma‐Aldrich, P2069) Sodium acetate (pH 5.5) (3 M, Invitrogen, AM9740) GlycoBlue (15 mg/ml) (Invitrogen, AM9515) Ethanol ssDNA linker (5’‐P‐NNNAGATCGGAAGAGCGTCGTGTAG‐3'‐C3) Sodium chloride (5M) (Sigma‐Aldrich, S6546) Circligase ssDNA Ligase (Epicentre, CL9021K) Gel loading buffer II (Invitrogen, AM8547) Novex TBE‐Urea Gels, 15% 10‐well (Invitrogen, EC6885BOX) SYBR Gold (Invitrogen, S11494) TEN250 buffer, 1 × (See recipe) E.Z.N.A. gel extraction kit (Omega Bio‐tek, D2500‐01) TopVision Agarose (Thermo Fisher Scientific, R0492) Low‐molecular‐weight DNA ladder (New England Biolabs, N3233S) Zero Blunt TOPO PCR Cloning Kit for Sequencing (Invitrogen, K2875J10) KAPA Library Amplification Kits (Roche, KK2612) NEBNext Multiplex Oligos for illumina (E7335S) Agilent RNA 6000 Pico Kit (Agilent, 5067) Microcentrifuge tubes, 1.7 ml Eppendorf Centrifuge (5427R) Benchtop contrifuge NanoDrop One spectrophotometer (Thermo Fisher Scientific) Illumina HiSeq 4000 platform Vortexing machine Rotary shaker (Eppendorf ThermoMixer) Refrigerator Thermal Cyclers for PCR XCell SureLock Mini‐Cell Electrophoresis System (Thermo Fisher) Benchmark Accuris MyView Compact UV Transilluminator (Merck) Agarose Gel Electrophoresis Systems ..

    Real-time Polymerase Chain Reaction:

    Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids.
    Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification.

    High Performance Liquid Chromatography:

    Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids.
    Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification.

    Purification:

    Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids.
    Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification.

    Synthesized:

    Article Title: Engineered self-driven intelligent nanomachine induced by target-mediated knock-on effect to determine attomolar nucleic acids.
    Article Snippet: There remain great challenges in improving amplification efficiency and detection specificity of enzymatic biosensing platforms for genetic disease diagnosis.. Herein, we constructed a single probe-based intelligent nanomachine (ESINM) to amplify cancer-related nucleic acids through engineered self-driven multiple cycles based on target-mediated knock-on effect.. Strategically, to make the most of each base, the well-designed versatile ESINM probe is made up of eight functional regions to implement target and enzyme recognition, intramolecular configuration transformation, signal amplification.

    Produced:

    Article Title: Method of DNA synthesis
    Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Low Molecular Weight DNA Ladder (New England Biolabs), 10×TLG buffer reagent: 300 mM Tris HCl pH 7.4 (Sigma Aldrich), 300 mM KCl (Sigma Aldrich), 75 mM MgCl2 (Sigma Aldrich), 50 mM (NH4)2SO4 (Sigma Aldrich), nuclease free water (Sigma Aldrich) IBA Oligonucleotides (5′ to 3′): PEGS1: BiotinC6 attached to SEQ ID No. 24, PEGS2: SEQ ID No. 25, PEGS3: SEQ ID No. 26, PEGS4: SEQ ID No. 27, PEGS5: SEQ ID No. 28, PEGS6: SEQ ID No. 29, PEGS7: SEQ ID No. 30. ..

    Concentration Assay:

    Article Title: Method of DNA synthesis
    Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Low Molecular Weight DNA Ladder (New England Biolabs), 10×TLG buffer reagent: 300 mM Tris HCl pH 7.4 (Sigma Aldrich), 300 mM KCl (Sigma Aldrich), 75 mM MgCl2 (Sigma Aldrich), 50 mM (NH4)2SO4 (Sigma Aldrich), nuclease free water (Sigma Aldrich) IBA Oligonucleotides (5′ to 3′): PEGS1: BiotinC6 attached to SEQ ID No. 24, PEGS2: SEQ ID No. 25, PEGS3: SEQ ID No. 26, PEGS4: SEQ ID No. 27, PEGS5: SEQ ID No. 28, PEGS6: SEQ ID No. 29, PEGS7: SEQ ID No. 30. ..

    Sensitive Assay:

    Article Title: Method of DNA synthesis
    Article Snippet: .. Reagents Dynabeads MyOne Streptavidin C1 (Life Technologies), NxGen Phi20 DNA polymerase (Lucigen), Protelomerase TelN produced in-house (stock concentration 20.5 μM), Exonuclease III (Enzymatics), dNTPs Mix (containing lithium salts) (Bioline), Nuclease free water (Sigma Aldrich), NaOH (Fisher Scientific), Qubit dsDNA BR (Broad Range) Assay Kit (Life Technologies), Qubit dsDNA HS (High Sensitivity) Assay Kit (Life Technologies), SafeWhite Nucleic Acid Stain (NBS Biologicals), Agarose (NBS Biologicals), Oligonucleotide S1, SEQ ID No. 23, (Oligo Factory), Low Molecular Weight DNA Ladder (New England Biolabs), 10×TLG buffer reagent: 300 mM Tris HCl pH 7.4 (Sigma Aldrich), 300 mM KCl (Sigma Aldrich), 75 mM MgCl2 (Sigma Aldrich), 50 mM (NH4)2SO4 (Sigma Aldrich), nuclease free water (Sigma Aldrich) IBA Oligonucleotides (5′ to 3′): PEGS1: BiotinC6 attached to SEQ ID No. 24, PEGS2: SEQ ID No. 25, PEGS3: SEQ ID No. 26, PEGS4: SEQ ID No. 27, PEGS5: SEQ ID No. 28, PEGS6: SEQ ID No. 29, PEGS7: SEQ ID No. 30. ..



    Similar Products

    molecular weight dna ladder  (New England Biolabs)
    96
    New England Biolabs molecular weight dna ladder
    Molecular Weight Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/low+molecular+weight+dna+ladder/Low+Molecular+Weight+DNA+Ladder/bio_rxiv__64898__2026__05__02__722398-181-29-33
    Average 96 stars, based on 1 article reviews
    molecular weight dna ladder - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    low molecular weight ladder  (New England Biolabs)
    96
    New England Biolabs low molecular weight ladder
    Low Molecular Weight Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/low+molecular+weight+dna+ladder/Low+Molecular+Weight+DNA+Ladder/us12590330-383-34-38
    Average 96 stars, based on 1 article reviews
    low molecular weight ladder - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    weight dna ladder  (New England Biolabs)
    96
    New England Biolabs weight dna ladder
    Weight Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/low+molecular+weight+dna+ladder/Low+Molecular+Weight+DNA+Ladder/pm41661055-43-5-25
    Average 96 stars, based on 1 article reviews
    weight dna ladder - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    low molecular weight dna ladder  (New England Biolabs)
    96
    New England Biolabs low molecular weight dna ladder
    Low Molecular Weight Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/low+molecular+weight+dna+ladder/Low+Molecular+Weight+DNA+Ladder/pmc12818100-219-50-55
    Average 96 stars, based on 1 article reviews
    low molecular weight dna ladder - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    quick load purple low molecular weight dna ladder  (New England Biolabs)
    94
    New England Biolabs quick load purple low molecular weight dna ladder
    Example of PAGE analysis of PCR amplification of LOOPER‐RT product. Lane <t>1,</t> <t>Quick‐Load</t> Purple Low Molecular Weight <t>DNA</t> Ladder; lane 2, no‐template control; lane 3, PCR amplification of LOOPER‐RT product using RTL‐3p and RTL‐T7p1 primers after 19 cycles. The full‐length amplicon is indicated.
    Quick Load Purple Low Molecular Weight Dna Ladder, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/low+molecular+weight+dna+ladder/Quick-Load+Purple+Low+Molecular+Weight+DNA+Ladder/pmc12794797-119-46-53
    Average 94 stars, based on 1 article reviews
    quick load purple low molecular weight dna ladder - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Example of PAGE analysis of PCR amplification of LOOPER‐RT product. Lane 1, Quick‐Load Purple Low Molecular Weight DNA Ladder; lane 2, no‐template control; lane 3, PCR amplification of LOOPER‐RT product using RTL‐3p and RTL‐T7p1 primers after 19 cycles. The full‐length amplicon is indicated.

    Journal: Current Protocols

    Article Title: Ligase‐Catalyzed Transcription and Reverse Transcription of XNA by T3 DNA Ligase

    doi: 10.1002/cpz1.70293

    Figure Lengend Snippet: Example of PAGE analysis of PCR amplification of LOOPER‐RT product. Lane 1, Quick‐Load Purple Low Molecular Weight DNA Ladder; lane 2, no‐template control; lane 3, PCR amplification of LOOPER‐RT product using RTL‐3p and RTL‐T7p1 primers after 19 cycles. The full‐length amplicon is indicated.

    Article Snippet: Cycle Pure Kit (Omega Bio‐tek, D6492‐02) 100% ethanol (required for Omega kit) 2× gel loading buffer with dyes (Invitrogen, cat. no. AM8547) Precast 10% polyacrylamide TBE‐urea gel (Bio‐Rad, cat. no. 4566033) 1× TBE buffer (see recipe) Low‐molecular‐weight DNA ladder: ssDNA ladder, 20/100 (IDT, cat. no. 51‐05‐15‐02) Quick‐Load Purple Low Molecular Weight DNA Ladder (NEB, cat. no. N0557S) DNA stain: ethidium bromide or SYBR Safe (Life Technologies) 3 M NaCl (see recipe) 10 μM RTL_T7p1 (Integrated DNA Technologies; Table ) 10 μM RTL‐3P (Integrated DNA Technologies; Table ) 1 mM degenerate 5‐phosphorylated DNA trinucleotide library [(51 mM‐P) (dN)(dN)(dN), Dharmacon, Horizon] in H 2 O 2× Q5 High‐Fidelity Master Mix (NEB M0492S) 0.2‐ml PCR tubes (Fisher, cat. no. 14230205) Vortex mixer (Scientific Industries, SI‐0236) Minicentrifuge (Corning, cat. no. 6770) Microcentrifuge (Eppendorf, cat. no. 5405000441) 1.5‐ml microcentrifuge tubes (VWR, cat. no. 87003‐294) Vacuum concentrator (SpeedVac SPD120, Thermo Scientific) Thermal cycler (Bio‐Rad, cat. no. 1861096) Vertical electrophoresis system (Bio‐Rad, cat. no. 1658004) Electrophoresis power supply (Bio‐Rad, cat. no. 1645050) Incubator (Corning, cat. no. 6800), preheated to 55°C Gel imaging system (Gel Doc XR+ Gel Documentation System, Bio‐Rad) Blue light transilluminator (BIO‐HELIX, cat. no. BP001CU) Aluminum foil or dark cabinet or drawer x‐tracta gel extraction tool (Sigma‐Aldrich, cat. no. Z722390) Centri‐Sep Spin Column (Princeton Separations, cat. no. CS‐900)

    Techniques: Amplification, Molecular Weight, Control